Skip to main content
Download PDF

Antimicrobial resistant Brucella spp. prevail in raw milk and animal feces of different livestock farms

BMC Microbiology volume 25, Article number: 231 (2025) Cite this article

Abstract

Background

Brucella spp. is a zoonotic pathogen that affects both livestock and humans, causing reproductive issues in animals and severe health complications in humans, including undulant fever, hepatomegaly, and arthritis. Contaminated raw milk and feces serve as potential transmission sources, despite its public health significance, limited studies have assessed the prevalence of Brucella spp. in raw milk and feces, particularly in endemic regions like Pakistan.

Objective

This study aimed to determine the prevalence of Brucella spp. in raw milk and feces of livestock in Punjab and Islamabad Capital Territory, Pakistan, and evaluate the antibiotic resistance profiles of the isolated strains.

Methods

The raw milk and fecal samples were collected randomly from the different livestock farms of Punjab, Pakistan. The areas were selected based on the different sociodemographic attributes like climate, land usage, number of animals, husbandry practices and operational convenience, which may influence the spatial and temporal distribution of livestock diseases. Brucella spp. was isolated using Brucella agar, a highly specific medium, and confirmed at the molecular level through IS711 gene analysis. Antibiotic susceptibility testing was performed to determine the multiple antibiotic resistance (MAR) index and identify multidrug-resistant (MDR) strains.

Results

A total of 100 samples, including 60 raw milk samples (cows = 25, buffalo = 25, goats = 10) and 40 fecal samples (cows = 16, buffalo = 15, goats = 9), were collected from various livestock farms. The incidence of Brucella spp. was found higher (7.5%) in raw milk than in the animal´s feca (15%). All the strains showed multiple antibiotic resistance (MAR) index (0.3–0.5) which was higher than the critical value (> 0.2). Additionally, 75% of the strains were classified as multidrug-resistant (MDR), highlighting their resistance to multiple antibiotics.

Conclusion

These findings indicate the antimicrobial resistance and prevalence of Brucella spp. in the dairy industry which could be a serious threat to public health.

Clinical trial number

Not applicable.

Peer Review reports

Introduction

Brucella, a Gram-negative coccobacillus, is a slow growing organism aerobically within its host. It comprises about twelve species, which include B. melitensis, B. abortus, B. canis, B. suis, B. neotomae, B. ovis, B. pinipedialis, B. ceti, B. microti, B. papionis, B. inopinata, and B. vulpis. Among these, B. melitensis and Brucella abortus are the invasive, highly pathogenic and more prevalent species in both animals and humans.

Brucellosis, caused by Brucella spp., is a major zoonotic disease affecting both animals and humans, leading to significant economic and public health concerns [1,2,3,6]. In livestock animals, brucellosis causes significant economic losses by decreasing the animal´ s productivity such as high abortions, stillbirths, infertility, insufficient milk production and increasing costs of husbandary paractices [4]. The harmful effects of disease on animal reproductive systems lead to certain barriers in their trade [5].

Diseased animals can excrete pathogen through sperm, blood, uterine secretions, urine, and animal products like raw milk and feces [4]. Consequently, Brucella (zoonotic pathogen) can be transmitted from infected animals to humans through primary transmission routes, including direct contact (skin of sick animals, secretions), inhalation (infected dust or aerosols) and consumption of dairy products (contaminated with infected animals) [4, 5]. Thus, brucellosis possess serious health risks to the people dealing with the livestock chain including the livestock handlers, slaughterhouse employees, and laboratory workers [5, 7].

The primary route of human infection is through the consumption of unpasteurized dairy products, such as raw milk and cheese, which are widely consumed in Pakistan and other endemic regions. Additionally, direct contact with infected animal secretions, such as feces or birth fluids, can lead to occupational exposure among farmers, veterinarians, and slaughterhouse workers [4, 5, 16]. In humans, brucellosis can cause joint pain, fever and fatigue, while chronic cases lead to severe health problems [35].

Brucellosis had posed significant public health challenges, especially in emerging nations in the Middle East and the Mediterranean basin, with multiple brucellosis outbreaks reported in Pakistan [1, 3, 8, 11]. It has been neglected in some regions near the India-Pakistan border and due to a lack of awareness, brucellosis cases continue to rise in Pakistan [9]. Recent studies have shown high prevalence of Brucella (16%) in different regions of Pakistan [10, 34] which was higher to that of other countries [7].

Effective detection and control of Brucella spp. rely on both culture-based and molecular techniques. Common tests to diagnose bovine brucellosis infection include serological tests like the Rose Bengal test, complement fixation test, ELISA, and PCR for detecting the bacteria [8, 13]. Culturomics methods are highly sensitive, low-priced, and reliable, which provide qualitative and quantitative results. While genomic methods like PCR based detection is consistent, sensitive and more reliable for diagnosis [12, 13]. Metagenomics is also used as a culture independent genomic analysis. However, it has more computational requirements, expensive and labor intensive. Certain genomic techniques coupled with culturomics like 16S rDNA also has limitations. The existence of multiple rRNA operons within a single genome, acquired by horizontal gene transfer, demonstrate variations in nucleotide composition. Hence, the detection of targeted microbes based on 16S rRNA gene could be misinterpreted [14]. Alternatively, IS711 gene with a high copy number per cell, is a more reliable choice for the detection of Brucella spp [15].

Although there is no effective treatment for brucellosis in cattle; management focuses on prevention and control. The most commonly used vaccines available are Brucella abortus strain 19 and RB51. Measures to control the infection include culling infected animals, regular testing, and vaccination programmes. As the disease can be transmitted from animals to humans, primarily through the consumption of unpasteurized milk or dairy products or contact with infected animals, This underscores the importance of robust control measures, including vaccination programmes, rigorous testing protocols, and strict biosecurity measures to prevent the spread of the disease both within cattle population and to humans.

Additionally, Brucella spp., an intracellular parasite, presents a challenge for conventional antimicrobial therapies. The human’s infection require long-term antibiotic therapy, which increases the risk of resistance development [36]. The growing prevalence of multidrug-resistant (MDR) Brucella isolates further underscores the treatment of Brucellosis in humans as antimicrobial resistance leads to the ineffectiveness of antibiotics and poses a high burden on health system. Given these challenges, the present study aims to investigate the prevalence and antimicrobial resistivity of B. arbotus in the raw milk and feces of livestock animals in Punjab, Pakistan.

Materials and methods

Study area and samples collection

The study was conducted in different regions of Pakistan including Islamabad, Rawalpindi, Gujar Khan, Sahiwal, and Sargodha (Fig. 1).

Fig. 1
figure 1

Map representing sampling areas

Full size image

The representative areas were selected from the different agro-ecological zones of Punjab (Fig. 1) which were characterized based on the climate, water availability, land use, number of animals, and operational convenience. The livestock farms within these areas, were selected based on the different sociodemographic attributes like climate, land usage, number of animals, husbandry practices and operational convenience, which may influence the spatial and temporal distribution of livestock diseases [25]. The sociodemographic characteristics of different farms included breed (Beetle, Kundi, Mix breed), age (2–4 years), farming practices/husbandry practices and feeding regime (2–3 times (dry feed /fodder) etc.). Milk and fecal samples were collected randomly from these livestock farms based on the availability of respective animals. A total 100 samples, 60 raw milks (cows = 25), (buffalos = 25), (goats = 10), and 40 animal’s feces samples of different animals (cows = 16), (buffalos = 15), and (goats = 9) were collected randomly from the different livestock farms of Punjab, Pakistan. For collecting the raw milk samples, teats were surface sterilized with 70% ethyl alcohol and sample was collected after dispatching the first 3–4 streams of milk. The fecal samples (10 g feces) were collected directly from the rectum of each animal while wearing a sterile plastic palpation glove. The samples were packed in sterile plastic zip locks, labeled, transported to the research laboratory, and stored at 4˚C. Each sample was meticulously labeled with a code, sample site, collection date, source, and animal type. All the samples (raw milk & animal feces) were transferred to the lab in an ice box and stored at -20 ºC. Each sample was examined in the laboratory within 24 h following collection.

Isolation from Raw milk and animal feces

Brucella spp. were isolated from raw milk and animals’ feces as described by Morales-Estrada et al. [17]. Each raw milk sample was centrifuged at 10,000 xg for 15 min, the sediment and creamy upper layer were pre-cultured. Bacteria were isolated by inoculating the raw milk samples on Brucella agar (Brucella medium base, 45 g/L) supplemented with selective antibiotics i.e., vancomycin (20 mg/L), and bacitracin (2 mg/L) which inhibit the growth of Gram - positive bacteria (S. typhimurium, S. aureus and Streptoccous spp). Additionally, nalidixic acid (5 mg/L) was included to suppress the growth of Gram - negative bacteria, except Brucella spp. Then the inoculated palates were incubated at 37 °C for 48–72 h. Animal’s feces were pre-cultured by putting 15 g of each sample in 200 mL of tryptic soy broth (0.5% yeast extract; 5% horse serum; 1% glucose) supplemented with antibiotics [bacitracin (2 mg/L), nalidixic acid (5 mg/L), and vancomycin (20 mg/L)], and incubated at 37 °C at 100 rpm for 48 h. Following incubation, it was centrifuged at 12,000 rpm for 30 min. The supernatant was discarded, and 0.5 mL of the pellet was streaked on Brucella agar (Brucella medium base, 45 g/L) supplemented with vancomycin (20 mg/L), nalidixic acid (5 mg/L), and bacitracin (2 mg/L) for 3–4 days at 37 °C. Colonies of presumptive Brucella isolates were picked, sub-cultured and stored in 20% glycerol at ­80 ºC.

Morphological and biochemical characterization

Presumptive colonies of Brucella were subjected to Gram staining and biochemical tests like catalase, oxidase, urease and motility [18].

Briefly, a single colony of Brucella spp. was smeared on a clean glass slide with the help of an inoculation loop and tested for Gram reaction. For catalase activity, 2 ml of hydrogen peroxide was dropped on the smear and observed after 2 min. Active bubbling indicated the catalase activity. For oxidase activity, 1 ml of oxidase reagent (P-aminomethyl aniline oxalate) was dropped on the colony and observed for 10 to 20 s. The filter paper turning dark purple indicated oxidase activity. For urease, a fresh culture of Brucella isolate was streaked on urea agar slant and incubated at 27 °C for 24 h. Appearance of purple and pink colour indicated urease production. Motility was assayed on motility agar (Beef extract 3 g/L, pancreatic digest of casein 10 g/L, sodium chloride 5 g/L, and agar 4 g/L) as described by Shields [18].

Molecular identification

Brucella spp. were identified based on the genus specific marker IS711 gene. The gene sequence was retrieved from the NCBI, analyzed in silico for different parameters like conserved, variable nucleotides, parsimony index, and singleton values.

Primers for 1S711 gene

New primers were developed by utilizing the conserved nucleotides of (IS711) gene. The nucleotide sequences of targeted gene were retrieved from the gene bank at NCBI, oriented in same direction i.e., 5’-3’, and analyzed for different parameters like conserved and variable nucleotides, singleton, and parsimonious informative sites. The conserved nucleotides (22–25) were selected from both ends of IS711 genes as putative forward and reverse primers (Fig S1). The properties of primers like melting temperatures, GC content, and length etc. were optimized at Just Bio (www.justbio.com). The primer sequences (5’-3’) were sent to Macrogen (Inc) Korea for oligosynthesis.

Amplification of IS711 gene

DNA of Brucella spp. was extracted by the CTAB method as described by [19] with certain modifications i.e., incubation time after addition of lysis buffer. Brucella vaccine RB-51 was used as a positive control and Bacillus spp strain was used as a negative control.

The gene (IS711) was amplified with the primers BR-ISF 5’TTGACGACCAAGCTGCATGC3’ and BR-ISR 5’ATGAATGCGGTCAATGTTTTCTCG3’. The PCR mixture consisted of Taq polymerase (1X), MgCl2 (1.5 mM), dNTPs (0.2 mM), Taq buffer (1X), each primer (0.1µM), and DNA (1.5 ng/µl). The cycling conditions consisted of initial denaturation (95 ºC for 5 min), followed by 35 cycles (94 ºC for 1 min), annealing (58 ºC for 30 s), denaturation (72 ºC for 2 min), and final extension (72 ºC for 10 min) [20]. The amplified PCR products were separated and visualized by subjecting them to 1% agarose gel electrophoresis The amplicons were compared Antimicrobial resistivity testing.

The antimicrobial resistivity of Brucella spp. was assessed using the Kirby-Bauer disc diffusion method, following the interpretive criteria and standards outlined by the Clinical and Laboratory Standards Institute (CLSI) and The European Committee on Antimicrobial Susceptibility Testing (EUCAST) [21, 33]. The antibiotic criteria reported for Haemophilus species (a zoonotic pathogen) was used as standard for Brucella spp as described in earlier studies [22]. The antibiotic discs (different antibiotic classes and frequently used in veterinary clinics) were used in the study which included streptomycin (10 µg), rifampin (5 µg), doxycycline (30 µg), trimethoprim /sulfamethoxazole (25 µg), kanamycin (30 µg), azithromycin (15 µg), colistin (10 µg), chloramphenicol (30 µg), ampicillin- sulbactum (20 µg) and imipenem (10 µg). Zones of inhibition were measured and compared with breakpoints given by CLSI [35] to designate susceptibility and resistivity. Multidrug resistance was defined as resistance to at least one antibiotic from a minimum of three different antibiotic classes [32].

Multiple antimicrobial resistance index (MAR)

The antimicrobial resistance index of isolates was calculated by using formula given below. MAR index = Total no. of antimicrobial resistance cases/Total no. of antimicrobial agents used.

Haemolysin assay

Hemolytic activity was determined as described by Roetzer et al. [23] with certain modifications as described below. Human blood (1 mL) taken freshly was mixed with 9 ml of PBS (phosphate buffer saline) and centrifuged at 4000 rpm for 5 min. The supernatant was discarded, and the pellet was resuspended in PBS by gentle pipetting. This washing step was repeated three times, with the final pellet dissolved in 9 ml of PBS (phosphate buffered saline). The bacterial suspension was prepared by suspending cells (picked with 2µL loop) in PBS to an optical density (OD600 nm) = 1. The hemolysis assay was performed in three groups: Group 1 (experimental) included 500 µl of RBC (red blood cells) suspension and 500 µl of bacterial suspension; Group 2 (negative control) had 500 µl of RBC suspension and 500 µl PBS; Group 3 (positive control) contained 250 µl of RBC suspension, 250 µl PBS, and 500 µl of 0.5% SDS. All samples were centrifuged at 5000 rpm for 5 min, incubated at 37 °C for 4 h, and then centrifuged again. The supernatant was collected, and OD was measured at 560 nm to assess the hemolytic activity.

Statistical analysis

The data was analyzed on Statistical package (statistics 8.0) by applying analysis of variance and Tukey´s test. Percentages were changed to arcsine for analysis and transformed back.

Results

Isolation and identification of Brucella spp

The isolates recovered on Brucella agar supplemented with antibiotics. The isolates were considered as presumptive Brucella spp. All the isolates were Gram-negative coccobacilli with a positive catalase, oxidase, and urease activity (Table 1; Fig. 2). A 13 out of 20 presumptive isolates were confirmed as Brucella arbotus based on the detection of housekeeping gene insertion element (IS711). The characteristics of housekeeping genes IS711 and 16S rRNA are given in Table 2 and the amplified product (345 bp) of IS711 gene is given in Figure 3.

Table 1 Location, source, and sample type of Brucella isolates
Full size table
Fig. 2
figure 2

Morphological and biochemical traits

Full size image
Table 2 IS711 and 16S rRNA genes informative profile statistics
Full size table
Fig. 3
figure 3

PCR amplification of IST7 gene from Brucella spp. L: DNA marker (1 kb, Thermo), P: Positive control (Brucella abortus RB-51), 1–13: Brucella spp.(MIc3, MIb12, M1b16, MRc20, MGc22, MGb28, MGg30, MSHb41, MSGc50, MSGc57, FRc64, FGb73, FGg75). No band was appeared in negative control

Full size image

Isolation rate of Brucella spp

Brucella spp. was found in 16.7% raw milk and 7.5% of fecal samples. The isolation rate for raw milk varied depending upon the source; it was higher in cow’s milk (8.3%) than buffalo´s (6.7%) and goat´s (1.66%) as shown in Tables 3 and 4.

Table 3 Brucella spp. Isolation rate from farm animals’ Raw milk and feces
Full size table
Table 4 Source wise distribution of Brucella positive and negative samples
Full size table

Antimicrobial resistance and hemolytic activity

All the Brucella spp. were examined for antimicrobial resistivity to ten different classes of antibiotics. The isolates MRc20, MGb28 and MGg30 showed highest MAR index = 0.5 followed that of MIc3, M1b16, MSHb41, MSGc57 and FGb73 (MAR index = 0.4), and MSGc50 (MAR index = 0.3). The isolates MRc20, MGb28, MGg30, MIc3, M1b16, MSHb41, MSGc57, FGb73 and MSGc50 were categorized as multi-drug resistant (MDR). Nine isolates were found as multidrug resistance (69.2%). The resistance pattern of the isolates is shown in Table 5; Fig. 4. All the isolates were found to be non-hemolytic.

Table 5 Brucella isolates MAR index and their phenotypic resistance
Full size table
Fig. 4
figure 4

Antibiotic resistivity and hemolytic activity of Brucella spp. (A) Inhibition zone (B) Antibiotic resistivity profile of Brucella spp. (C) Resistance percentage of antibiotics (D) Hemolysis assay (a) positive control, (b) negative control and (c) Brucella isolate with non-hemolysis production. *STR = Streptomycin, KAN = Kanamycin, IMP = Imipenem, CST = Colistin, SXT = Trimethoprim-Sulfamethoxazole, DOX = Doxycyclin, RD = Rifampicin, AZI = Azithromycin, CMP = Chloramphenicol, A/S = Ampicillin- sulbactum

Full size image

Discussion

Brucellosis is a serious zoonotic disease that leads to abortion in small ruminants and cattle’s, across the world. It poses a serious threat to livestock as well as public health. Emerging of antimicrobial resistance in Brucella spp., as a consequence of various factors prevailing in developing nations especially Pakistan like irrational use of antibiotics, traditional veterinary practices and lack of environment management etc., underscores the treatment of Brucellosis in humans. Furthermore, antimicrobial resistance results in the ineffectiveness of antibiotics and thus poses a high risk to human treatment.

It is thought to be endemic to Pakistan, where cases have been reported in canines, humans, small ruminants, camels, and domestic cattle. The present conditions in farm animals indicates a clear zoonotic threat to human health. Hence, in current study, the incidence of Brucella species was investigated in the raw milk and animal’s feces. The study was conducted in Punjab, a major province that contributes 55–62% of the livestock production in Pakistan.

The sampling was conducted from the different livestock farms present at the different districts of Punjab. The isolation rate of Brucella spp. was found higher in buffalo´s raw milk than that of the cow and goat while it was consistent in all animal’s feces. The IS711 gene is considered as an ideal molecular marker for the identification of Brucella spp. due to its certain characteristics like copy number, species specificity and differentiation capabilities unlike the 16S rRNA gene which lacks the ability to delineate the species within same genera and can target any genus of a bacterium. These advantages make IS711 the preferred target for molecular diagnostic techniques especially PCR [24].

Several factors contribute to the dissemination of Brucella. It transmits from animals to humans through direct contact, aborted materials, and by consumption of contaminated dairy products [1, 3, 26]. This is largely due to a lack of knowledge and awareness about the burden of brucellosis and its transmission methods. There is insufficient collaboration between policymakers, health professionals, and stakeholders. To effectively combat brucellosis, we urge policymakers and veterinary professionals to implement and enforce stronger disease control measures. This includes enhancing vaccination programs, improving diagnostic capabilities, and strengthening biosecurity regulations. Medical professionals and veterinary sectors need more information about the epidemiology and risk factors of brucellosis. Farmers are hesitant to use available live-attenuated vaccines because they fear introducing the strains into their farms, thereby risking infection. Effective diagnosis, surveillance, and control of brucellosis require comprehensive knowledge of its epidemiology and standard diagnostic capabilities. The current lack of proper diagnostic tools and methods hampers these efforts. The World Health Organization (WHO) recommends specific antibiotic combinations for curing brucellosis in humans, such as doxycycline paired with rifampicin or fluoroquinolones combined with rifampicin. Previous studies on antimicrobial sensitivity testing for Brucellae are limited, with the Kirby Bauer and E-test techniques being commonly employed methods. As previously noted by the World Health Organization (WHO), there are limited antibiotics with clinical efficacy and effective intracellular penetration for managing brucellosis [27]. Kanamycin (30.7%), colistin (76.9%), trimethoprim-sulfamethoxazole (15.3%), rifampicin (84.6%), chloramphenicol (53.8%) and ampicillin- sulbactum (92.3%) resistance were found in Brucella strains in this study. Previously reported data indicates a substantial resistance rate to rifampin in Egyptian field strains (64%), as well as in Brazil (36.73%), and Malaysia (70%) [28]. Rifampin, an antibiotic utilized for brucellosis treatment, operates by inhibiting bacterial RNA and protein production, rendering it bactericidal and its high intracellular transport imparts an in vitro inhibitory effect against several Brucella strains [27].

Our findings align with previous studies, reinforcing the observation that there is an absence of resistance to streptomycin, doxycycline [29] azithromycin [30] regimens among Brucella strain.

Frequent and irrational use of antibiotics in management of brucellosis lead to the emergence of antimicrobial resistance in Brucella spp. Hence, antimicrobial resistivity profile of the Brucella spp. helps to assess the risks associated with the brucellosis. This study specifically investigates a group of antibiotics commonly employed in the treatment of brucellosis.

Brucella exhibits an escalating trend in antimicrobial resistance, prompting curiosity about the absence of classical AMR genes in its genome. This absence may stem from undiscovered Brucella-specific AMR genes not yet present in public AMR databases. The intracellular lifestyle of Brucellae, impeding antimicrobial penetration, could slow resistance development. Recent years have revealed heightened rates of brucellosis relapse and an increase in antimicrobial resistance within the Brucella phenotype [31].

Limitations and future prospects

The study is limited by random sampling with a sample size (n = 100) thereby restricting its geographic scope to Punjab and Islamabad, which may not reflect the entire country’s situation. The amplicons were compared with the positive control (Brucella vaccine RB-51) and negative control (Bacillus spp). However, the bands should be cloned and sequenced in further studies. Future research should focus on investigating resistance mechanisms and identifying potential undiscovered Brucella-specific AMR genes. Advanced molecular techniques could help in understanding antimicrobial resistance patterns. Expanding the study to different regions and livestock species would provide a more comprehensive analysis.

Conclusion

The study conducted in Punjab highlights the higher incidence of Brucella arbotus in buffalo’s raw milk compared to other livestock, emphasizing the need for targeted prevention strategies. The study also underscores several factors contributing to the transmission of Brucella from animals to humans, including inadequate awareness, poor veterinary practices, and insufficient collaboration between health professionals and policymakers. The research found significant antimicrobial resistance (AMR) in Brucella strains, particularly to commonly used antibiotics like rifampicin, kanamycin, and chloramphenicol, which poses a challenge to treatment efficacy. There is a pressing need for improved diagnostic capabilities, better education for farmers, and enhanced coordination between health and veterinary sectors to mitigate the risks posed by Brucellosis.

Data availability

All data generated or analysed during this study are included in this published article [and its supplementary information files].

References

  1. Namdev N, Makhijani R, Dorshetwar K, Parate M, Shukla JL, Husain AA, Kashyap RS. Features responsible for spread of zoonotic disease Brucella: A study on central India population. SN Comput Sci. 2025;6(1):1–19.

    Google Scholar 

  2. Dadar M, Alamian S. In Silico MLVA analysis of Brucella melitensis from human and livestock in Iran. Curr Microbiol. 2025;82(2):1–9.

    Article  Google Scholar 

  3. Menshawy AM, Vicente AF, Hegazy YM, Djokic V, Hamdy ME, Freddi L, Elbauomy EM, Sayour AE, Ponsart C, Abdel-Hamid NH. Animal brucellosis in Egypt: review on evolution, epidemiological situation, prevalent Brucella strains, genetic diversity, and assessment of implemented National. Control Measures Microorganisms. 2025;13(1):170. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ijfoodmicro.2021.109192.

    Article  CAS  PubMed  Google Scholar 

  4. Udainiya S, Tiwari A, Singh B, Ahirwar MK. Infectious abortive diseases: brucellosis. Elements of Reproduction and Reproductive Diseases of Goats; 2025. pp. 307–18.

  5. Alhamzi G, Chaudhary A, Sharma S, Dubey S, R., Alkahtani BST. Characterizing the behavior of solutions in a fractal-fractional model of bovine brucellosis in cattle. Appl Math Sci Eng. 2025;33(1):2458619.

    Article  Google Scholar 

  6. Tian Z, Jiang S, Yuan P, Wang X, Pei J, Tang H, Chen Y. Mapping Risks: A Value Chain Approach to Brucellosis Introduction in Zhijiang’s Cattle Population, China. Preventive Veterinary Medicine; 2025. p. 106467.

  7. Liu Z, Gao L, Wang M, Du S, Yuan M, Li Z. Global species/biovars and genotype diversity atlas of Brucella spp.—102 countries, 1923– 2020. China CDC Wkly. 2025;7(4):144.

    PubMed  PubMed Central  Google Scholar 

  8. Yousaf R, Khan I, Shehzad W, Hussain R, Ali S, Neubauer H, et al. Seroprevalence and molecular detection of brucellosis in hospitalized patients in Lahore hospitals, Pakistan. Infect Dis Rep. 2021;13(1):166–72.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Ullah S, Jamil T, Asif M, Ahmad W, Neubauer H. Brucellosis remains a neglected disease in district Muzaffargarh of Pakistani Punjab: A call for multidisciplinary collaboration. Ger J Vet Res. 2022;2(1):35–8.

    Article  Google Scholar 

  10. Hussain A, Hussain S, Chaudhry M, Ali MA, Elsohaby I, Sparagano O. Prevalence and herd-level risk factors associated with Brucella infection in smallholders keeping large ruminants. Res Vet Sci. 2025;183:105506.

    Article  PubMed  Google Scholar 

  11. Laine CG, Johnson VE, Scott HM, Arenas-gamboa AM. Global Estimate Hum Brucellosis Incidence. 2023;29(9):1789–97.

  12. Nowrotek M, Jałowiecki Ł, Harnisz M, Płaza GA. Culturomics and metagenomics: in Understanding of environmental resistome. Front Environ Sci Eng. 2019;13(3).

  13. Dong Q, Chen J, Wei Q, Liu J, Shen G, Liu B et al. Ultrasensitive detection of pathogenic bacteria by targeting high copy signature genes. Front Vet Sci. 2022;9(April).

  14. Martellacci L, Quaranta G, Patini R, Isola G, Gallenzi P, Masucci L. A literature review of metagenomics and culturomics of the peri-implant microbiome: current evidence and future perspectives. Mater (Basel). 2019;12(18).

  15. Nardi G, Francisco F. Comparative study of IS711 and bcsp31 -based polymerase chain reaction (PCR) for the diagnosis of human brucellosis in whole blood and serum samples. J Microbiol Methods. 2021;183(December 2020):106182. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.mimet.2021.106182.

    Article  CAS  Google Scholar 

  16. Jansen W, Demars A, Nicaise C, Godfroid J, Bolle X, De, Reboul A et al. Shedding Brucella melitensis Happens Through Milk Macrophages in the Murine Model ofInfect ion. Scientific Reports, 10(1), 9421.2020;–0

  17. Morales-Estrada AI, Hernández-Castro R, López-Merino A, Singh-Bedi J, Contreras-Rodríguez A. Isolation, identification, and antimicrobial susceptibility of Brucella spp. Cultured from cows and goats manure in Mexico. Arch Med Vet. 2016;48(2):231–5.

    Article  Google Scholar 

  18. Shields P, Cathcart L. Motil Test Medium Protoc 2011 American society for microbiology, 214, 215.

  19. Andreou LV. Preparation of genomic DNA from bacteria. Methods in Enzymology. Volume 529, 1st ed. Elsevier Inc.; 2013. pp. 143–51. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/B978-0-12-418687-3.00011-2.

  20. Sambu RM, Mathew C, Nonga HE, Lukambagire AS, Yapi RB, Akoko J et al. Circulating Brucella species in wild animals of the Serengeti ecosystem, Tanzania. One Heal Outlook. 2021;3(1).

  21. Humphries RM, Ambler J, Mitchell SL, Castanheira M, Dingle T, Hindler JA, et al. CLSI methods development and standardization working group best practices for evaluation of antimicrobial susceptibility tests. J Clin Microbiol. 2018;56(4):1–26.

    Article  Google Scholar 

  22. Asadi FT, Hashemi SH, Alikhani MY. Clinical and Diagnostic Aspects of Brucellosis and Antimicrobial Susceptibility of Brucella Isolates in Hamedan, Iran. 2017;(11):235–8.

  23. Roetzer A, Haller G, Beyerly J, Geier CB, Wolf HM, Gruener CS, et al. Genotypic and phenotypic analysis of clinical isolates of Staphylococcus aureus revealed production patterns and hemolytic potentials unlinked to gene profiles and source. BMC Microbiol. 2016;1–14. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12866-016-0630-x.

  24. Ocampo-Sosa AA, García-Lobo JM. Demonstration of IS711 transposition in Brucella Ovis and Brucella pinnipedialis. BMC Microbiol. 2008;8:1–10.

    Article  Google Scholar 

  25. Saeed U, Ali S, Latif T, Rizwan M, Attaullah, Iftikhar A, Neubauer H. Prevalence and Spatial distribution of animal brucellosis in central Punjab, Pakistan. Int J Environ Res Public Health. 2020;17(18):6903.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Hikal AF, Wareth G, Khan A, Brucellosis. Why is it eradicated from domestic livestock in the united States but not in the nile river basin countries? Ger J Microbiol. 2023;3(2):19–25.

  27. Elbehiry A, Aldubaib M, Rugaie O, Al, Marzouk E, Abaalkhail M, Moussa I et al. Proteomics-based screening and antibiotic resistance assessment of clinical and sub- clinical Brucella species: an evolution of brucellosis infection control. 2022;1–19. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0262551

  28. Alamian S, Dadar M, Etemadi A, Afshar D, Alamian MM. Antimicrobial susceptibility of Brucella spp. Isolated from Iranian patients during 2016 to 2018. 2019;11(5):363–7.

  29. Liu Z, guo, Di D, dong, Wang M, Liu R, hong, Zhao Hyan, Piao D, ri, et al. In vitro antimicrobial susceptibility testing of human Brucella melitensis isolates from Ulanqab of inner Mongolia, China. BMC Infect Dis. 2018;18(1):1–6.

  30. Wareth G, El-diasty M, Abdel-hamid NH, Holzer K, Hamdy MER, Moustafa S, et al. Molecular characterization and antimicrobial susceptibility testing of clinical and non-clinical Brucella melitensis and Brucella abortus isolates from Egypt. One Heal. 2021;13:100255. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.onehlt.2021.100255.

    Article  CAS  Google Scholar 

  31. Jiang W, Chen J, Li Q, Jiang L, Huang Y, Lan Y et al. Epidemiological characteristics, clinical manifestations and laboratory findings in 850 patients with brucellosis in Heilongjiang Province, China. 2019;1–6.

  32. Rafailidis PI, Kofteridis D. Proposed amendments regarding the definitions of multidrug-resistant and extensively drug-resistant bacteria. Expert Rev anti-infective Therapy. 2022;20(2):139–46.

    Article  CAS  PubMed  Google Scholar 

  33. EUCAST. (2015). The European Committee on Antimicrobial Susceptibility Testing. The European Committee on Antimicrobial Susceptibility Testing, 0–77. http://www.eucast.org

  34. Soomro AH, Kamboh AA, Rind R, Dawani P, Sarwar M, Abro SH, Awais M. A study on prevalence and risk factors of brucellosis in cattle and buffaloes in district Hyderabad, Pakistan. J Anim Health Prod. 2014;2:33–7.

    Article  Google Scholar 

  35. Ling J, Luo J, Wu W, Lei X, Zhou W, Kuang L, Liu X. Brucella bloodstream infection mimicking systemic juvenile idiopathic arthritis: a pediatric case report. BMC Infect Dis. 2025;25:233.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Bandyopadhyay S. Zoonotic antimicrobial resistance: impact on human and animal health. Neglected zoonoses and antimicrobial resistance. Academic; 2025. pp. 333–40.

Download references

Acknowledgements

We acknowledge the Pakistan Science Foundation for funding this study under the grant number PSF/NSLP/C-820. The authors would like to extend their sincere appreciation to the Researchers Supporting Project number (RSPD2025R694), King Saud University, Riyadh, Saudi Arabia.

Funding

All consumables used to conduct the experiments in this study were funded by the Pakistan Science Foundation for funding this study under the grant number PSF/NSLP/C-820.

Author information

Authors and Affiliations

  1. Department of Biosciences, COMSATS University Islamabad (CUI), Park Road, Islamabad, Pakistan

    Shaista Zeb, Humaira Yasmin & Muhammad Nadeem Hassan

  2. Department of Biotechnology, University of Sarghodha, Sargodha, Pakistan

    Imran Riaz Malik

  3. Department of Zoology, College of Science, King Saud University, Riyadh, 11451, Saudi Arabia

    Mohammad Abul Farah

  4. Division of Soil Science and Agriculture Chemistry, Sher e Kashmir, University of Agricultural Sciences and Technology, Jammu, India

    Vivak M. Arya

Authors
  1. Shaista Zeb
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Humaira Yasmin
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Imran Riaz Malik
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Mohammad Abul Farah
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Vivak M. Arya
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Muhammad Nadeem Hassan
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; agreed on the journal to which the article has been submitted; and agreed to be accountable for all aspects of the work.

Corresponding author

Correspondence to Muhammad Nadeem Hassan.

Ethics declarations

Ethics approval and consent to participate

No permissions were necessary to collect the specimens in this study as no experiment was conducted on humans. However, the study was ethically approved by the ethics review board, Department of Biosciences, COMSATS University Islamabad via letter number CUI/Bio/ERB/11-2023/3.

Ethics and consent to participate for publication

The informed consent from the owner(s) was obtained prior to collect the samples from animals used in this study.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zeb, S., Yasmin, H., Malik, I.R. et al. Antimicrobial resistant Brucella spp. prevail in raw milk and animal feces of different livestock farms. BMC Microbiol 25, 231 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12866-025-03930-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12866-025-03930-8

Keywords

BMC Microbiology

ISSN: 1471-2180

Contact us