Skip to main content
Download PDF

Bacillus paralicheniformis SYN-191 isolated from ginger rhizosphere soil and its growth-promoting effects in ginger farming

BMC Microbiology volume 25, Article number: 75 (2025) Cite this article

Abstract

Background

The use of chemical fertilizers and pesticides and the farming without crop rotation may negatively impact the microbial community and the quality of the soils in ginger farm. It is important to improve soil properties to promote the healthy growth of ginger in ginger farm.

Results

We isolated and identified the pathogenic Fusarium ramigenum from infected ginger roots. We then isolated a new Bacillus paralicheniformis strain SYN-191 from the rhizosphere soil around healthy ginger roots, and showed B. paralicheniformis SYN-91 could inhibit F. ramigenum growth, degrade proteins, dissolve silicate, and decompose cellulose. SYN-191 treatment significantly improved the agronomic traits of ginger seedlings in healthy soil and continuous cropping soil. Furthermore, SYN-191 treatment restructured the microbial microbiomes in rhizosphere soil, including reducing the number of harmful fungi, such as Fusarium, and increasing the beneficial bacterial populations such as Bacillus and Pseudomonas. Field experiments showed that SYN-191 application increased ginger yield by 26.47% (P < 0.01). Whole-genome sequencing of strain SYN-191 revealed the relevant genes for antibiotic synthesis, potassium dissolution, and cellulose decomposition.

Conclusions

A new plant-growth-promoting B. paralicheniformis SYN-191 was obtained. This strain could antagonize ginger root rot pathogenic fungus, improve agronomic traits and ginger yield in field, and improve the microbial community structure in the ginger rhizosphere soil. This study provides a valuable bacterial resource for overcoming obstacles in the continuous cropping of ginger.

Peer Review reports

Background

Ginger roots, containing several functional polyphenols and terpenoids [1], are the important food ingredients and broadly applied in cosmetics and natural medicine [2, 3]. Ginger is farmed in several main planting areas in China with annual output taking ∼ 80% of the global production [4]. However, the use of chemical fertilizers and pesticides and the long-term continuous cropping have been causing serious problems in ginger farming, including soil degradation, accumulation of pathogenic microorganisms, accumulation of autotoxic substances, and imbalances in the soil microbiome [5,6,7]. This challenges the current ginger farming in China and limits the sustainable development of the ginger planting industry. Pragmatic solutions are needed to overcome the continuous cropping obstacles in ginger farms.

The microbial communities (rhizosphere microbiomes) around plant roots are important for healthy growth of crops in agroecosystems [8, 9]. Plant growth-promoting rhizobacteria (PGPR) can increase soil nitrogen fixation, release soil nutrients, regulate plant growth hormone levels, improve systemic tolerance in plants, and therefore promote plant growth and improve soil quality [10, 11]. The known PGPR include Bacillus, Pseudomonas, Azotobacter, Rhizobium, and Paenibacillus [12]. Among them, Bacillus species have the advantages including easy preservation and robustness, and are previously used to overcome soil obstacles, compaction, and soil-borne diseases.

Bacillus paralicheniformis was classified independently from Bacillus licheniformis due to its distinct genetic characteristics [13]. We showed the presence of the synthetic gene clusters of the antimicrobial substances fengycin, bacitracin, and lantipeptide in B. paralicheniformis but not B. licheniformis [14]. Consistently, two genetic markers of fenC and fenD from the fengycin operon were used to distinguish B. paralicheniformis from B. licheniformis [13]. B. paralicheniformis has been used as a microbial biocontrol agent [15] and shown the rapid establishment in the rhizosphere [16] and secreting antibacterial substances to control plant pathogenic diseases such as tomato Fusarium wilt [17]. Moreover, it can stimulate plant defense mechanisms and promote the growth of the crops like wheat, rice, cotton, and quinoa [18,19,20,21]. B. paralicheniformis can also remove harmful substances from industrial wastewater [22, 23]. It has been used as a functional food in dairy products [24] and an animal feed additive [25]. Furthermore, B. paralicheniformis had strong adaptability to extreme environments [26], such as high temperatures [27], high salinity, and strongly acidic and basic environments [28]. B. paralicheniformis is generally regarded as safe in the uses for agricultural and industrial production. The impacts of B. paralicheniformis on ginger farming and soil microbiomes remain unclear.

In this study, the pathogenic F. ramigenum was isolated from rotten ginger roots and a new B. paralicheniformis strain SYN-191 was isolated from the rhizosphere soil around healthy ginger roots in Anqiu City, China. The interactions between ginger, strain SYN-191, and the soil were characterized as well as the changes in soil microbiomes. Genes related to growth promotion and disease prevention in strain SYN-191 were also identified, which may relate to the alleviation of continuous cropping obstacles in ginger farming.

Methods

Isolation and screening of pathogenic fungi and bacterial strains from ginger rhizosphere

Pathogenic fungi were screened from ginger tissues with root rot using the method of tissue separation [29, 30]. Ginger tissues with root rot were washed with sterile water and dried to expose the affected area. Under sterile conditions, the surface of the disease site was soaked with 3% NaClO3 solution for 3–5 min, then immersed in 75% ethanol for 30 s, repeatedly rinsed with sterile water for 2–3 min each time, and then the excess water on the surface was wiped. Next, the pathological tissues were cut into 5 mm×5 mm ginger slices with sterile blades, and then transferred onto solid potato-dextrose agar (PDA) medium to incubate at 28 ℃ for five days. After a large number of colonies grew on plates, the resulted fungi were separated, purified, sequenced, and then stored.

The rhizosphere soil of healthy ginger in Anqiu City, China was used to isolate growth-promoting rhizobacteria (PGPR). Rhizosphere soil (10 g) was added in 90 mL sterile water with glass beads and mixed at 37 ℃ and 180 rpm for 30 min. The suspension was spread on Luria-Bertani (LB) solid agars, and the agar plates were incubated at 37 ℃ for 24 h. Colonies with different sizes and shapes were streaked on fresh agar plates to isolate the pure strains.

The 18 S rDNA of fungi and 16 S rDNA of bacteria were sequenced (Beijing Genomics Institution, China) for strain identification. The primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used to amplify the 18 S rDNA of fungi. The primers 27 F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) were used to amplify the 16 S rDNA of bacteria. Phylogenetic tree analysis of 18 S rDNA or 16 S rDNA sequences (constructed using MEGA 11.0) were performed for strain confirmation [21, 31].

The tieback test of pathogenicity

Healthy ginger pieces were disinfected as mentioned above. The control group was treated with 2 mL of sterile water, and the treatment group was treated with 1 mL of sterile water and 1 mL of liquid containing fungal spores. Three replicates were performed for each group. The treated ginger pieces were incubated at 28 ℃ for five to seven days. The presence of pathogenic fungi that cause root rot in ginger was verified according to Koch’s rule [29].

Inhibition experiment of bacteria against pathogenic fungi

The inhibitory effects of antagonistic bacteria against pathogenic fungi were investigated using the plate confrontation method and Oxford cup assay [31].

For the plate confrontation method, pathogenic fungi were recovered on PDA plates. After the mycelia covered the plate, sterile hole punchers were used to make the mycelian agar pieces. The mycelian agar pieces were transferred to the center of new PDA plates using tweezers and grown at 28 ℃ for one day. The antagonistic bacteria were streaked with sterile toothpicks to 2 cm away from the edge of pathogenic fungi. The plates were further placed at 28 ℃ for another two to five days. Three independent experiments were performed for each test.

For the Oxford cup assay, the pathogenic fungi were recovered on PDA plates with the full cover of agar surface. Spore suspensions were collected from the surface using sterile water. The sterile Oxford cups were placed evenly on the fresh agar plates, prepared from 15 to 20 mL of 2% agar in water. Semi-solid PDA medium (15–20 mL) mixed with 1% spore suspension was poured upon the base agar. The Oxford cup was removed after solidification. Antagonistic bacteria suspension (100 μL) was added into the holes and the plates were incubated at 37 ℃ for 24 h for observation of inhibitory zones. Three independent experiments were performed for each test.

Testing the growth-promoting functions of different strains

The bacteria strains were inoculated with sterile toothpicks on the agars containing casein, silicate, or carboxymethylcellulose (CMC) to evaluate the dissolution of proteins, silicate, or cellulose, respectively. The formulas for these media were prepared, and the results were analyzed as previously described [32,33,34]. Microbial microbiochemical identification tubes (Shenzhen Haibo Biotechnology, China) were used to detect the biochemical ability of strains. Three independent experiments were performed for each test.

Pot experiments and field test

Strain SYN-191 was inoculated in 5 mL LB liquid medium and cultured at 37 ℃ and 180 rpm for 12 h as the seed solution. Seed solution (1 mL) was added into 50 mL of the LB liquid medium. The culture was grown for another 10 h. The effective number of SYN-191 was estimated as 108 CFU/mL for further use.

Four groups were used in the pot experiments: CK-JK (control group with healthy soil), 191-JK (treatment group with healthy soil and SYN-191), CK-LZ (control group with continuously cropped soil), and 191-LZ (treatment group with continuously cropped soil and SYN-191). Five independent experiments were performed for each group. Equal-sized pieces of ginger were germinated for two weeks. After growth, ginger buds of the same size were selected and transplanted to pots containing 1 kg of soil and matrix. When the first leaf grew after approximately fourteen days, the ginger plants were transferred to the control soil taken from the lawn soil. To ensure better survival rates of the ginger seedlings, the initial ginger seedlings were planted in continuous cropping soil (ginger soil taken from a continuous cropping field with rotten ginger root diseases) after the 15-day growth in healthy control soil. One week after replantation, 200 mL of strain diluted SYN-191 solution (viable cell number ≥ 106 CFU/mL) was directly applied into the soil. After forty days of growth, agronomic traits such as physiological plant height, stem diameter, root length, aboveground dry and fresh weights, and underground dry and fresh weights of ginger seedlings were measured. Ginger plant and rhizosphere soil samples were collected as well to determine the enzyme activities, chlorophyll content of ginger leaves, and changes in soil flora.

For the field demonstration, evenly sized pieces of ginger with buds were selected to conduct ginger field experiments in Anqiu City, China. The bacterial samples of strain SYN-191 (≥ 106 CFU/mL) were applied twice (planting and seedling stage) with 50 L strain solution per hectare. One hundred ginger seedlings were used for each group.

Effects of strain SYN-191 on rhizosphere soil flora of ginger

Rhizosphere soil (10–15 g) from each independent experiment in groups CK-JK, 191-JK, CK-LZ, and 191-LZ was selected after forty days of plant growth and placed in 100 mL centrifuge tubes in an ice bath. Soil samples were washed with 0.86% NaCl solution 1–2 times, centrifuged at 4 ℃ and 12,000 rpm for 30 min, and the supernatant was removed. The total DNA of the sampled soils were extracted and stored at -80 ℃, and the samples were then sent to Shanghai Personal Biotechnology Co., Ltd (Shanghai, China) for further testing.

Total soil DNA was extracted using the TIANamp Soil DNA Kit (TIANGEN, Beijing, China). Primers 5´ ACTCCTACGGGAGGCAGCA (forward) and 5´ GGACTACHVGGGTWTCTAAT (reverse) were used to amplify the bacterial hypervariable regions (V3-V4) of 16 S rDNA, and primers 5´ GGAAGTAAAAGTCGTAACAAGG (forward) and 5´ GCTGCGTTCTTCATCGATGC (reverse) were used to amplify the fungal internal transcriptional spacers. The PCR products were purified, and sequencing libraries were prepared using the TruSeg Nano DNALT Library Prep Kit (lllumina, San Diego, CA, USA). Finally, high-throughput sequencing was performed on an Illumina sequencing platform (MiSeg) using a MiSeq Reagent Kit v2 (500 cycles). Finally, sequence splicing and quality control were performed using the analysis process of Vsearch software [35]. The cumulative curves of Specaccum species (https://en.wikipedia.org/wiki/Rank_abundance_curve) were drawed using the R language and QIIME2 (2019.4) software. The R language and pheatmap packages were used to calculate the clustering results of each sample and taxon and are presented in the form of an interactive graph. The species abundance distribution trend of each sample was used to compare the differences in species composition among the samples.

Whole genome sequencing and analysis of strain SYN-191

A genome-wide shotgun approach was used to construct a library of different insertions in the genome of strain SYN-191. Based on the second-generation Illumina sequencing platform and third-generation PacBio single-molecule long-read sequencing technology, the genome of strain SYN-191 was sequenced. An Illumina Novaseq library was prepared using the TruSeqTM Sample Prep Kit, and a 2 × 150 bp library was generated. A third-generation sequencing library was inserted at 20 kb using Template Prep Kit 1.0. For the second-generation sequencing results, FastQC was adopted to carry out data quality control, and AdapterRemoval was adopted to remove the 3’ end joint pollution [36]. SOAPec performed quality correction for all reads based on Kmer frequency (Kmer set value was 17) [37], and 98.43% of high-quality reads (HQ reads) were obtained. The data obtained by PacBio were spliced using HGAP and CANU software to obtain the containing sequences [38, 39]. The Pilon software was used to correct the results of the third generation, and the complete genome sequence was obtained by splicing [40].

Secondary metabolic gene clusters in the SYN-191 genome were predicted using antiSMASH (http://antismash.secondarymetabolites.org/help.html). Assembly, annotation, and visualization of the SYN-191 genome were performed using Proksee (https://proksee.ca/) program [41]. The collinearity analysis of B. paralicheniformis SYN-191 (CP120920.1), B. paralicheniformis BP9 (GCA_032467935.1), B. paralicheniformis MDJK30 (CP020352.1), B. paralicheniformis Bac84 (CP023665.1), Bacillus haynesii P19 (CP0594949.1), B. licheniformis SCDB14 (CP014842.1), and Bacillus sonorensis L12 (AOFM00000000) was performed using Artemis Comparison Tool (https://github.com/sanger-pathogens/Artemis?tab=readme-ov-file).

Statistical analysis

GraphPad Prism software (v 9.0) was used for plotting, one-way analysis of variance (ANOVA), and Duncan’s multiple-range test as reported [12].

Results

Isolation of pathogenic fungi from rotten ginger roots

The rotten ginger roots were collected from Anqiu City. The fungus J-5 was isolated (Fig. 1A). The tieback test confirmed that fungus J-5 could cause root rot in ginger (Fig. 1B) and that it could also be isolated from reinfected and diseased ginger slices. Furthermore, 18 S rDNA sequence analysis confirmed that fungus J-5 is a common pathogen F. ramigenum in ginger root rot (Fig. 1C).

Fig. 1
figure 1

Isolation and identification of Fusarium ramigenum J-5. The colony diagram of pathogenic fungus J-5 of ginger root rot disease (A). The tieback test of fungus J-5 on ginger slices (B). A total of 2 mL sterile water was added to the CK group and 1 mL of sterile water and 1 mL spore solution of fungus J-5 was added to the treatment group. The evolutionary tree analysis results of 18 S rDNA sequence of fungus J-5 (C)

Full size image

Isolation and characterization of rhizosphere bacteria

A total of 300 bacterial clones were isolated from the rhizosphere soil. In combination with inhibitory tests and functional medium screening, a biocontrol and growth-promoting strain, SYN-191, was identified (Fig. 2A), which inhibited F. ramigenum J-5 (Fig. 2B). The colony of strain SYN-191 was irregularly shaped, with a dry protrusion on the surface, a moist and sticky interior, and a slightly transparent white color (Fig. 2A). The cells were rod-shaped and Gram-positive (Fig. 2C). Strain SYN-191 formed a transparent circle on tyrosine medium, a transparent oil droplet on silicate medium, and a transparent circle on bacterial CMC medium, showing that strain SYN-191 had the ability to degrade proteins, silicate, and cellulose, respectively (Fig. 2D and E, and 2F, respectively). Furthermore, physiological and biochemical experiments showed that strain SYN-191 could effectively use rhamnose, sucrose, glucose, trehalose, fructose, maltose, and arabinose as carbon sources but could not use raffinose, lactose, and xylose. Moreover, strain SYN-191 exhibited catalase activity, production of acetylmethylcarbinol, and reduction of nitrate to nitrite.

Fig. 2
figure 2

Characteristics of strain SYN-191. The colony morphology of strain SYN-191 (A). The antagonistic effect on F. ramigenum J-5 (B). Strain SYN-191 could inhibit the normal growth of F. ramigenum J-5 after five days of culture at 28 ℃. Gram staining of strain SYN-191 (C). Strain SYN-191 had the transparent circle on tyrosine medium (D), the transparent oil droplet on silicate medium (E), and the transparent circle on bacterial CMC medium (F). All the results were obtained from one of three independent experiments

Full size image

Effects of strain SYN-191 on ginger seedlings under different conditions

Because of the long growth cycle of ginger, we firstly investigated whether strain SYN-191 had good biocontrol and growth-promoting effects using greenhouse pot experiments and evaluated its effect on the growth of ginger seedlings in control healthy soil and continuous cropping soil. The application of strain SYN-191 solution to healthy soil and continuous cropping soil with obstacles significantly promoted the growth of ginger seedlings (Fig. 3A and F). As shown in Fig. 3B and E, for the healthy soil, SYN-191 treatment increased plant height by 61.10% (P < 0.05), stem diameter by 36.78% (P < 0.05), root length by 30.35%, above-ground dry weight by 189.79% (P < 0.01), above-ground fresh weight by 61.90% (P < 0.01), underground dry weight by 43.53%, and underground fresh by 88.92% (P < 0.01). In continuously cropping soil, SYN-191 treatment increased plant height by 41.97%, stem diameter by 15.48%, above-ground dry weight by 223.83% (P < 0.01), above-ground fresh weight by 94.19% (P < 0.01), underground dry weight by 96.83% (P < 0.01), and underground dry fresh weight by 93.36% (P < 0.05). However, in continuously cropped soil with obstacles, the root length decreased by 12.38% in treatment samples, but there was no significant difference. As shown in Fig. 3F, SYN-191 application effectively increased the chlorophyll content in ginger leaves. In pot experiments with healthy soil, the chlorophyll content of leaves in the treatment group of strain SYN-191 was significantly higher than that in the control group (P < 0.01), whereas in continuously cropped soil with obstacles, the chlorophyll content in the treatment group also increased but it was not significant.

Fig. 3
figure 3

Effects of strain SYN-191 solution on ginger seedlings under different soil conditions. Growth state of ginger seedlings for forty days after strain SYN-191 was applied or not (A), under the condition of healthy soil and continuous cropping soil with obstacles. CK-JK (control group in healthy soil), 191-JK (treatment group in healthy soil and SYN-191), CK-LZ (control group in continuously cropping soil), and 191-LZ (treatment group in continuously cropping soil and SYN-191). The physiological plant heights (B), stem diameters (C), root lengths (D), above-ground dry and fresh weights, underground dry and fresh weights (E), and the chlorophyll contents of leaves (F) of ginger seedlings treated with strain SYN-191 or not were shown. All the results were obtained from three independent experiments. The means and standard errors of the means for all three independent experiments are shown. “*” indicates P < 0.05 and “**” indicates P < 0.01. “ns” indicates non-significant

Full size image

Changes of rhizosphere microbial communities in strain SYN-191 treatment

To further characterize the effects of strain SYN-191 on the rhizosphere microbial communities, the microbial communities in ginger rhizosphere soil were investigated using high-throughput sequencing. The application of strain SYN-191 re-adjusted the rhizosphere microbial communities in healthy soil and continuously cropped soil; and the microbial richness in soil with continuously cropping obstacles was approximately half that in healthy soil (Fig. 4A and B). SYN-191 treatment changed the composition of bacterial and fungal communities in the rhizosphere soil of ginger. According to the species composition heatmap (Fig. 4C and D), the genera Methyloversatilis, Bacillus, Hydrogenophaga, Humicola, Chaetomium, and Stachybotrys exhibited the dramatic significant changes after SYN-191 treatment.

The significantly upregulated and downregulated microbial groups were further analyzed. In healthy soil, Pseudomonas, Sphingomonas, Azoarcus, Hydrogenophaga, and Pseudoxanthomonas were relatively more abundant in the strain SYN-191 treatment group, and their richness increased by 59.51%, 26.67%, 85.14%, 288.18%, and 66.67%, separately, compared to the control. The relative abundances of the bacteria Methyloversatilis and Azohydromonas decreased in the SYN-191 treatment group by 7.06% and 80.34%, separately. The relative abundances of the fungi Fusarium, Fusicolla, and Cylindrocarpon in the strain SYN-191 treatment group increased by 30.64%, 126.92%, and 1938.46%, separately. The relative abundances of fungi Humicola, Mortierella, Chaetomium, Gibberella, Clonostachys, and Botryotrichum were decreased in the strain SYN-191 treatment group by 52.99%, 38.82%, 77.88%, 23.08%, 47.33%, and 59.23%, separately.

In continuous cropping soil, the relative abundances of bacteria Pseudomonas, Methyloversatilis, Bacillus, Hydrogenophaga, and Pseudoxanthomonas in the SYN-191 treatment group increased by 31.47%, 536.54%, 113.03%, 120.74%, and 3.45%, separately. The relative abundances of Sphingomonas, Azoarcus, Azohydromonas, and Arenimonas decreased by 32.45%, 73.71%, 79.00%, and 49.44%, separately. Regarding to fungi in the SYN-191 treatment group, the abundance of Fusicolla, Humicola, Chaetomium, and Stachybotrys increased by 22.41%, 525.67%, 141.56%, and 1034.48%, separately, whereas the abundance of Fusarium decreased by 17.61%.

Fig. 4
figure 4

Effects of strain SYN-191 on microbial communities in ginger rhizosphere soil of ginger. The Alpha diversity and abundance grade curves of bacteria (A) and fungi (B) in the rhizosphere soil in healthy soil and continuous cropping soil. OTU, the classification operation unit; ASV, amplicon Sequence variant. The Rank abundance curve reflects the distribution of ASV/OTU abundance in each sample. According to different similarity levels, all sequences are divided. If the similarity between sequences is higher than 97%, they can be defined as an OTU, and each OTU represents a species. The horizontal axis mainly represents the richness of species, with the larger the value, the higher the richness of species. The smoothness of the curve reflects the uniformity of species distribution in the samples. The heat maps of composition of ginger rhizosphere species in healthy soil and continuous cropping soil with obstacles (bacteria: C; and fungi: D). The presented results were obtained from three independent experiments

Full size image

Field application of strain SYN-191 in ginger farm

To investigate the impacts of the application of strain SYN-191 on ginger farming, a continuous cropping field for ginger farming in the Anqiu area was selected (Fig. 5A). Experimental results showed (Fig. 5B and D) that SYN-191 treatment increased the physiological plant height by 8.38% (P < 0.01), stem diameter by 4.86% (P < 0.05), ginger width by 13.99% (P < 0.05), branch number by 43.26% (P < 0.01), leaf width by 3.28%, leaf number by 8.73%, ginger weight by 27.37% (P < 0.05), and total weight of ginger by 27.91% (P < 0.05). The treatment with strain SYN-191 significantly improved the growth of underground ginger tubers and increased the yield by 26.47% (P < 0.01) (Fig. 5E). These showed that SYN-191 treatment improved the surface agronomic traits of ginger seedlings and significantly increased their yield.

Fig. 5
figure 5

SYN-191 treatment in ginger farming in Anqiu area. The land has been used in ginger farming for continuous five years. Ginger farm and ginger crops (A, B, and C). The yield-related indexes of ginger experimental field in Anqiu area (D and E). All the results were obtained from three independent experiments. The means and standard errors of the means for all three independent experiments are shown. “*” indicates P < 0.05 and “**” indicates P < 0.01. “ns” indicates non-significant

Full size image

Genome analysis of strain SYN-191 and the genes relevant to biocontrol and growth-promoting features

The species and relevant functional genes of strain SYN-191 were identified using whole-genome sequencing analysis. The whole genome of strain SYN-191 was a circular chromosome (Fig. 6); the total length of the genome assembly sequence was 4,288,118 bp, and the GC content was 45.96%. A total of 203 non-coding RNA, 24 RNA, 81 tRNA, and 98 ncRNAs were identified. According to average nucleotide identity (ANI) and collinearity analysis (Supplementary Fig. S1), the genome of SYN-191 showed the greatest similarity to B. paralicheniformis Bac84. We therefore confirm that strain SYN-191 is B. paralicheniformis. The chromosomal sequence of strain SYN-191 was uploaded to NCBI GenBank (https://www.ncbi.nlm.nih.gov/nuccore/NZ_CP120920.1/). The registration number was CP120920.1, the BioProject number was PRJNA224116, and the BioSample number was SAMN33788273.

Fig. 6
figure 6

Complete genome map of strain SYN-191. From the inner to the outer, the first circle represents the sequence scale, the second circle represents GC skew, the third circle represents the GC content, the fourth and seventh circles represent the COG to which each CDS belongs, the fifth and sixth circles represent the positions of CDS, tRNA, and rRNA in the genome

Full size image

Secondary metabolic gene clusters in SYN-191 were analyzed using antiSMASH (Supplementary Fig. S2). Eleven secondary metabolic gene clusters were predicted in the genome of SYN-191. Four gene clusters are same or highly identical to the reported gene clusters of lichenysin (100%), fengycin (86%), bacitracin (100%), and bacillibactin (100%). In addition, according to genomic analysis, strain SYN-191 harbored genes related to the synthesis of hemolysin, aurachin D, and kanamycin, such as bacD, acpP, ntdC, ntdB, and ntdA (Supplementary Table S1). Therefore, we postulate that strain SYN-191 could produce various antimicrobial substances to inhibit harmful microorganisms, thus competing with pathogenic strains in the rhizosphere ecological niche and indirectly promoting the growth of ginger plants.

The demand for potassium is high in the planting and growth cycles of ginger. Through prediction of genomic information, transport genes related to potassium dissolution, such as kdpA, kdpC, and kefF were identified (Supplementary Table S2). In addition, strain SYN-191 decomposed cellulose. The genes bglA, MAN, and gmuG of strain SYN-191 might relate to the utilization of cellulose (Supplementary Table S3), which might decompose polysaccharides in the soil into monosaccharides and increase nutrient availability in soil (Fig. 7).

Discussion

Continuous cropping obstacles are common in ginger farming areas, with frequent root rotten diseases and other diseases affecting plant growth and development. A strain B. paraclicheniformis SYN-191 was isolated from the rhizosphere soil of a ginger farm in Anqiu City, China. SYN-191 showed growth-promoting effects on ginger, such as inhibiting root rot pathogen, degrading proteins, resolving potassium, and decomposing cellulose.

Strain SYN-191 significantly promoted ginger seedling growth. According to previous studies, B. paralicheniformis can directly act on the plant rhizosphere [16], and promote seedling growth or seed germination of wheat, rice, cotton, quinoa, and other crops [18,19,20,21]. In this study, the isolate SYN-191 of B. paralicheniformis not only promoted the growth of ginger seedlings and increased the chlorophyll content of leaves, but also significantly improved the yield of ginger. The yield of ginger roots treated with strain SYN-191 increased by 26.47% (P < 0.01), indicating the high application potentials of SYN-191.

PGPR may function directly in the rhizosphere environment of plants through secreting and absorbing specific metabolites to affect the responses to biological and abiotic stresses [42]. However, microbe–plant and microbe–microbe relationship networks are of complexity and diversity, and susceptible to many factors, such as the environment and native microbial community structure of the soil. The details remain to be explored. A comprehensive understanding on growth-promoting effects of PGPR is important to elaborate plant-microbial interactions [43, 44]. Previous studies showed the application of B. paralicheniformis improved soil microbial diversity in the rhizosphere of tobacco and rapeseed, and reduced the incidence of diseases in continuous cropping soil and healthy soil [45, 46]. Here, we focused on the effects of B. paralicheniformis SYN-191 in ginger farming, in both healthy soil and continuous cropping soil. We further explored its influence on soil microbiomes. Previously, PGPR applications such as Bacillus was shown significantly improving soil microbial community richness and species diversity [47, 48]. However, this study found that the application of strain SYN-191 reduced the richness of the soil microbial community. The diversity and richness of microbial species in soil with continuous cropping obstacles were lower than those in healthy soil. In response to this phenomenon, studies had shown that in poor soil environments, the addition of “foreign microorganisms” could increase the competition for soil resources, resulting in a decrease in microbial richness and diversity [49]. The soil microecological environment is susceptible to contamination by “foreign microorganisms” [50]. Another study confirmed that the addition of “foreign microorganisms” would change the original soil microecological balance in a short period of time, inhibit the growth of some native microorganisms, and reduce the number of microbial species in plant rhizosphere soil [45]. In the present study, we applied strain SYN-191 to both healthy and continuously cropped soils. Although strain SYN-191 reduced the richness of the soil microbial community to a certain extent, it also improved the soil health status to a certain extent and changed the composition of the soil microbiomes in the ginger rhizosphere. A similar microbiome suitable for ginger growth was successfully formed [49].

When SYN-191 was applied to both healthy and continuously cropped soils, Hydrogenophaga and Fusicolla were significantly enriched in the ginger rhizosphere. Hydrogenophaga is a well-known class of aromatic hydrocarbon-degrading bacteria that degrades several harmful pollutants [51, 52]. Fusicolla can control plant invasions by Alternaria alternata and other pathogenic fungi [53, 54]. In healthy soil, strain SYN-191 increases communities of Sphingomonas and Pseudomonas, which can promote plant growth and reduce cadmium toxicity [55]. In the continuous cropping soil, the application of strain SYN-191 significantly increased the number of common PGPR, such as Bacillus, and inhibited the number of Fusarium spp., which effectively increased the number of beneficial microorganisms and reduced the number of pathogenic microorganisms.

Fig. 7
figure 7

Schematic diagram of the interaction mechanism between B. paralicheniformis SYN-191, soil, and ginger

Full size image

Under biological or abiotic stress, rhizosphere microorganisms can increase crop yield by activating beneficial substances or secreting bacteriostatic substances [56]. Therefore, rhizosphere microorganisms could be used as potential agents for biofertilizer production, which could reduce the use of chemical pesticides or fertilizers [46], and overcome continuous cropping obstacles. Furthermore, the whole genome of strain SYN-191 was sequenced to explore its biocontrol mechanism and the genes related to its biocontrol and growth-promoting capacities. According to ANI analysis with related type species B. paralicheniformis Bac84, B. haynesii P19, B. licheniformis SCDB14, and B. sonorensis L12 [57], the similarities between strain SYN-191 and B. paralicheniformis Bac84 or B. haynesii P19 were both ≥ 95%. However, the similarity and collinearity analysis results of strain SYN-191 with B. paralicheniformis Bac84 were higher; therefore, SYN-191 was identified as B. paralicheniformis. The results showed that strain SYN-191 harbored genes related to antibiotic synthesis, silicate dissolution, and cellulose decomposition, which correspond to its disease-preventing and growth-promoting functions. Regarding the antibiotic synthesis-related genes of SYN-191, eleven secondary metabolic gene clusters were predicted using the antiSMASH program. The lichenysin, fengycin, bacitracin, and bacillibactin synthetic gene clusters of strain SYN-191 were over 80% similar to the existing antibiotic synthetic gene clusters. Lichenysin and fengycin have been shown to inhibit the growth of various plant pathogens [58, 59]. Bacitracin is an important natural antibacterial product produced by B. licheniformis and Bacillus subtilis and has a broad antibacterial spectrum, strong activity, and low drug resistance [60]. Bacillibactin has an antagonistic effect on Pseudomonas syringae pv. tomato [61]. The fengycin and bacitracin gene clusters present in the SYN-191 genome are also thought to be important features for distinguishing B. paralicheniformis from B. licheniformis [14].

B. paralicheniformis SYN-191 was shown to be an important PGPR able to promote ginger growth and improve the microbial ecological environment of ginger rhizosphere soil. B. paralicheniformis SYN-191 can be further explored for development of green microbial fertilizers.

Conclusions

In this study, F. ramigenum J-5 was isolated as the ginger root rot disease pathogen, and the growth-promoting effects of B. paralicheniformis SYN-191 were characterized. The application of strain SYN-191 had a positive effect on the agronomic traits of ginger seedlings in healthy soil and in continuous cropping soil. SYN-191 regulated the microbial ecological environment in ginger rhizosphere soil. The whole genome of strain SYN-191 was further analyzed, and the functional genes relevant to plant disease prevention and growth promotion were identified. This study provided a reference for understanding the interaction between B. paralicheniformis and ginger and exemplified the use of B. paralicheniformis as a green microbial agent. Further studies can focus on elaborating the mechanisms for B. paralicheniformis regulating the microbiomes in rhizosphere soil.

Data availability

The raw data generated by genome sequencing can be found in the NCBI Genome as BioProject number PRJNA224116 and BioSample number SAMN33788273. The raw data generated by analysis of soil microbial diversity can be found in the NCBI Sequence Read Archive as BioProject number PRJNA1074497 and PRJNA1081132. Other data are provided within the manuscript or supplementary information.

References

  1. Haniadka R, Saldanha E, Sunita V, Palatty PL, Fayad R, Baliga MS. A review of the gastroprotective effects of ginger (Zingiber officinale Roscoe). Food Funct. 2013;4(6):845–55. https://doiorg.publicaciones.saludcastillayleon.es/10.1039/c3fo30337c

    Article  PubMed  Google Scholar 

  2. Stoner GD. Ginger: is it ready for prime time? Cancer Prev Res (Phila). 2013;6(4):257–62. https://doiorg.publicaciones.saludcastillayleon.es/10.1158/1940-6207.CAPR-13-0055

    Article  PubMed  Google Scholar 

  3. Mao QQ, Xu XY, Cao SY, Gan RY, Corke H, Beta T, Li HB. Bioactive compounds and bioactivities of ginger (Zingiber officinale Roscoe). Foods. 2019;8(6):185. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/foods8060185

    Article  PubMed  PubMed Central  Google Scholar 

  4. Langner E, Greifenberg S, Gruenwald J. Ginger: history and use. Adv Ther. 1998;15(1):25–44.

    PubMed  Google Scholar 

  5. Li Y, Chi J, Ao J, Gao X, Liu X, Sun Y, Zhu W. Effects of different continuous cropping years on bacterial community and diversity of cucumber rhizosphere soil in solar-greenhouse. Curr Microbiol. 2021;78(6):2380–90. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00284-021-02485-x

    Article  PubMed  Google Scholar 

  6. Chen Y, Du J, Li Y, Tang H, Yin Z, Yang L, Ding X. Evolutions and managements of soil microbial community structure drove by continuous cropping. Front Microbiol. 2022;13:839494. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fmicb.2022.839494

    Article  PubMed  PubMed Central  Google Scholar 

  7. Liu H, Li Y, Ge K, Du B, Liu K, Wang C, Ding Y. Interactional mechanisms of Paenibacillus polymyxa SC2 and pepper (Capsicum annuum L.) suggested by transcriptomics. BMC Microbiol. 2021;21(1):70. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12866-021-02132-2

    Article  PubMed  PubMed Central  Google Scholar 

  8. Berg G, Zachow C, Müller H, Philipps J, Tilcher R. Next-generation bio-products sowing the seeds of success for sustainable agriculture. Agronomy. 2013;3(4):648–56. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/agronomy3040648

    Article  Google Scholar 

  9. Bulgarelli D, Schlaeppi K, Spaepen S, van Ver Loren E, Schulze-Lefert P. Structure and functions of the bacterial microbiota of plants. Annu Rev Plant Biol. 2013;64:807–38. https://doiorg.publicaciones.saludcastillayleon.es/10.1146/annurev-arplant-050312-120106

    Article  PubMed  Google Scholar 

  10. Maheshwari R, Kumar P, Bhutani N, Suneja P. Exploration of plant growth-promoting endophytic bacteria from Pisum sativum and Cicer arietinum from South-West Haryana. J Basic Microbiol. 2022;62(7):857–74. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/jobm.202100575

    Article  PubMed  Google Scholar 

  11. Nadeem SM, Ahmad M, Zahir ZA, Javaid A, Ashraf M. The role of mycorrhizae and plant growth promoting rhizobacteria (PGPR) in improving crop productivity under stressful environments. Biotechnol Adv. 2014;32(2):429–48. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.biotechadv.2013.12.005

    Article  PubMed  Google Scholar 

  12. Zhang J, Zhao J, Fu Q, Liu H, Li M, Wang Z, Gu W, Zhu X, Lin R, Dai L, Liu K, Wang C. Metabolic engineering of Paenibacillus polymyxa for effective production of 2,3-butanediol from poplar hydrolysate. Bioresour Technol. 2024;392:130002. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.biortech.2023.130002

    Article  PubMed  Google Scholar 

  13. Olajide AM, Chen S, LaPointe G. Markers to rapidly distinguish Bacillus paralicheniformis from the very close relative, Bacillus licheniformis. Front Microbiol. 2021;11:596828. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fmicb.2020.596828

    Article  PubMed  PubMed Central  Google Scholar 

  14. Du Y, Ma J, Yin Z, Liu K, Yao G, Xu W, Fan L, Du B, Ding Y, Wang C. Comparative genomic analysis of Bacillus paralicheniformis MDJK30 with its closely related species reveals an evolutionary relationship between B. Paralicheniformis and B. Licheniformis. BMC Genomics. 2019;20(1):283. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12864-019-5646-9

    Article  PubMed  PubMed Central  Google Scholar 

  15. Ahire JJ, Kashikar MS, Lakshmi SG, Madempudi R. Identification and characterization of antimicrobial peptide produced by indigenously isolated Bacillus paralicheniformis UBBLi30 strain. 3 Biotech. 2020;10(3):112. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s13205-020-2109-6

    Article  PubMed  PubMed Central  Google Scholar 

  16. Asif M, Li-Qun Z, Zeng Q, Atiq M, Ahmad K, Tariq A, Al-Ansari N, Blom J, Fenske L, Alodaini HA, Hatamleh AA. Comprehensive genomic analysis of Bacillus paralicheniformis strain BP9, pan-genomic and genetic basis of biocontrol mechanism. Comput Struct Biotechnol J. 2023;21:4647–62. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.csbj.2023.09.043

    Article  PubMed  PubMed Central  Google Scholar 

  17. Jinal HN, Sakthivel K, Amaresan N. Characterisation of antagonistic Bacillus paralicheniformis (strain EAL) by LC-MS, antimicrobial peptide genes, and ISR determinants. Antonie Van Leeuwenhoek. 2020;113(8):1167–77. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s10482-020-01423-4

    Article  PubMed  Google Scholar 

  18. Chaparro-Encinas LA, Parra-Cota FI, Cruz-Mendívil A, Santoyo G, Peña-Cabriales JJ, Castro-Espinoza L, de Los Santos-Villalobos S. Transcriptional regulation of cell growth and reprogramming of systemic response in wheat (Triticum turgidum subsp. durum) seedlings by Bacillus paralicheniformis TRQ65. Planta. 2022;255(3):56. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00425-022-03837-y

    Article  PubMed  Google Scholar 

  19. Annapurna K, Govindasamy V, Sharma M, Ghosh A, Chikara SK. Whole genome shotgun sequence of Bacillus paralicheniformis strain KMS 80, a rhizobacterial endophyte isolated from rice (Oryza sativa L). 3 Biotech. 2018;8(5):223. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s13205-018-1242-y

    Article  PubMed  PubMed Central  Google Scholar 

  20. Xu J, Qin L, Xu X, Shen H, Yang X. Bacillus paralicheniformis RP01 enhances the expression of growth-related genes in cotton and promotes plant growth by altering microbiota inside and outside the Root. Int J Mol Sci. 2023;24(8):7227. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ijms24087227

    Article  PubMed  PubMed Central  Google Scholar 

  21. Xie T, Shen S, Hu R, Li W, Wang J. Screening, identification, and growth promotion of antagonistic endophytes associated with Chenopodium quinoa against quinoa pathogens. Phytopathology. 2023;113(10):1839–52. https://doiorg.publicaciones.saludcastillayleon.es/10.1094/PHYTO-11-22-0419-R

    Article  PubMed  Google Scholar 

  22. Allam NG, Ismail GA, El-Gemizy WM, Salem MA. Biosynthesis of silver nanoparticles by cell-free extracts from some bacteria species for dye removal from wastewater. Biotechnol Lett. 2019;41(3):379–89. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s10529-019-02652-y

    Article  PubMed  Google Scholar 

  23. Muccee F, Ejaz S, Riaz N. Toluene degradation via a unique metabolic route in indigenous bacterial species. Arch Microbiol. 2019;201(10):1369–83. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00203-019-01705-0

    Article  PubMed  Google Scholar 

  24. Liang X, Dai N, Yang F, Zhu H, Zhang G, Wang Y. Molecular identification and safety assessment of the potential probiotic strain Bacillus paralicheniformis HMPM220325 isolated from artisanal fruit dairy products. Food Funct. 2024;15(2):747–65. https://doiorg.publicaciones.saludcastillayleon.es/10.1039/d3fo04625g

    Article  PubMed  Google Scholar 

  25. EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP), Bampidis V, Azimonti G, Bastos ML, Christensen H, Dusemund B, Durjava M, Kouba M, López-Alonso M, Puente SL, Marcon F, Mayo B, Pechová A, Petkova M, Ramos F, Sanz Y, Villa RE, Woutersen R, Prieto M, Anguita M, García-Cazorla Y, Innocenti ML, López-Gálvez G, Pettenati E, Revez J, Vettori MV, Brozzi R. Safety and efficacy of a feed additive consisting of Bacillus paralicheniformis DSM 5749 and Bacillus subtilis DSM 5750 (BioPlus® 2B) for piglets, calves for fattening and other growing ruminants (chr. Hansen A/S). EFSA J. 2023;21(3):e07859. https://doiorg.publicaciones.saludcastillayleon.es/10.2903/j.efsa.2023.7859

    Article  PubMed  Google Scholar 

  26. Wang Y, Yu Y, Duan Y, Wang Q, Cong X, He Y, Gao C, Hafeez M, Jan S, Rasheed SM, Cheng S, Wang Z. Enhancing the activity of carboxymethyl cellulase enzyme using highly stable selenium nanoparticles biosynthesized by Bacillus paralicheniformis Y4. Molecules. 2022;27(14):4585. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/molecules27144585

    Article  PubMed  PubMed Central  Google Scholar 

  27. Kalwasińska A, Krawiec A, Deja-Sikora E, Gołębiewski M, Kosobucki P, Swiontek Brzezinska M, Walczak M. Microbial diversity in deep-subsurface hot brines of northwest Poland: from community structure to isolate characteristics. Appl Environ Microbiol. 2020;86(10):e00252–20. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/AEM.00252-20

    Article  PubMed  PubMed Central  Google Scholar 

  28. Dunlap CA, Kwon SW, Rooney AP, Kim SJ. Bacillus paralicheniformis sp. nov., isolated from fermented soybean paste. Int J Syst Evol Microbiol. 2015;65(10):3487–92. https://doiorg.publicaciones.saludcastillayleon.es/10.1099/ijsem.0.000441

    Article  PubMed  Google Scholar 

  29. Lin L, Han S, Yang X, Xiao L, Zhu Y, Chen J. First report of Vacuiphoma Oculihominis causing fruit rot on navel orange (Citrus sinensis) in China. Plant Dis. https://doiorg.publicaciones.saludcastillayleon.es/10.1094/PDIS-09-23-1970-PDN

  30. Li N, Xu D, Huang RH, Zheng JY, Liu YY, Hu BS, Gu YQ, Du Q. A new source of diterpene lactones from Andrographis paniculata (burm. f.) nees-two endophytic fungi of Colletotrichum sp. with antibacterial and antioxidant activities. Front Microbiol. 2022;13:819770. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fmicb.2022.819770

    Article  PubMed  PubMed Central  Google Scholar 

  31. Wang C, Zhao D, Qi G, Mao Z, Hu X, Du B, Liu K, Ding Y. Effects of Bacillus velezensis FKM10 for promoting the growth of Malus hupehensis Rehd. And inhibiting Fusarium verticillioides. Front Microbiol. 2020;10:2889. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fmicb.2019.02889

    Article  PubMed  PubMed Central  Google Scholar 

  32. Mosca CO, Moragues MD, Llovo J, Al Mosaid A, Coleman DC, Pontón J. Casein agar: a useful medium for differentiating Candida Dubliniensis from Candida albicans. J Clin Microbiol. 2003;41(3):1259–62. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/JCM.41.3.1259-1262.2003

    Article  PubMed  PubMed Central  Google Scholar 

  33. Raturi G, Sharma Y, Rana V, Thakral V, Myaka B, Salvi P, Singh M, Dhar H, Deshmukh R. Exploration of silicate solubilizing bacteria for sustainable agriculture and silicon biogeochemical cycle. Plant Physiol Biochem. 2021;166:827–38. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.plaphy.2021.06.039

    Article  PubMed  Google Scholar 

  34. Kang M, Chhetri G, Kim J, Kim I, Seo T. Pontibacter cellulosilyticus sp. nov., a carboxymethyl cellulose-hydrolysing bacterium isolated from coastal water. Int J Syst Evol Microbiol. 2021;71(10). https://doiorg.publicaciones.saludcastillayleon.es/10.1099/ijsem.0.005058

  35. Rognes T, Flouri T, Nichols B, Quince C, Mahé F. VSEARCH: a versatile open source tool for metagenomics. PeerJ. 2016;4:e2584. https://doiorg.publicaciones.saludcastillayleon.es/10.7717/peerj.2584

    Article  PubMed  PubMed Central  Google Scholar 

  36. Schubert M, Lindgreen S, Orlando L. AdapterRemoval v2: rapid adapter trimming, identification, and read merging. BMC Res Notes. 2016;9:88. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13104-016-1900-2

    Article  PubMed  PubMed Central  Google Scholar 

  37. Luo R, Liu B, Xie Y, Li Z, Huang W, Yuan J, He G, Chen Y, Pan Q, Liu Y, Tang J, Wu G, Zhang H, Shi Y, Liu Y, Yu C, Wang B, Lu Y, Han C, Cheung DW, Yiu SM, Peng S, Xiaoqian Z, Liu G, Liao X, Li Y, Yang H, Wang J, Lam TW, Wang J. SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. Gigascience. 2012;1(1):18. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/2047-217X-1-18

    Article  PubMed  PubMed Central  Google Scholar 

  38. Chin CS, Peluso P, Sedlazeck FJ, Nattestad M, Concepcion GT, Clum A, Dunn C, O’Malley R, Figueroa-Balderas R, Morales-Cruz A, Cramer GR, Delledonne M, Luo C, Ecker JR, Cantu D, Rank DR, Schatz MC. Phased diploid genome assembly with single-molecule real-time sequencing. Nat Methods. 2016;13(12):1050–4. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nmeth.4035

    Article  PubMed  PubMed Central  Google Scholar 

  39. Koren S, Walenz BP, Berlin K, Miller JR, Bergman NH, Phillippy AM. Canu: scalable and accurate long-read assembly via adaptive k-mer weighting and repeat separation. Genome Res. 2017;27(5):722–36. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/gr.215087.116

    Article  PubMed  PubMed Central  Google Scholar 

  40. Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo CA, Zeng Q, Wortman J, Young SK, Earl AM. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS ONE. 2014;9(11):e112963. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0112963

    Article  PubMed  PubMed Central  Google Scholar 

  41. Grant JR, Enns E, Marinier E, Mandal A, Herman EK, Chen CY, Graham M, Van Domselaar G, Stothard P. Proksee: in-depth characterization and visualization of bacterial genomes. Nucleic Acids Res. 2023;51(W1):W484–92. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkad326

    Article  PubMed  PubMed Central  Google Scholar 

  42. Bukhat S, Imran A, Javaid S, Shahid M, Majeed A, Naqqash T. Communication of plants with microbial world: exploring the regulatory networks for PGPR mediated defense signaling. Microbiol Res. 2020;238:126486. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.micres.2020.126486

    Article  PubMed  Google Scholar 

  43. Kumawat KC, Razdan N, Saharan K. Rhizospheric microbiome: bio-based emerging strategies for sustainable agriculture development and future perspectives. Microbiol Res. 2022;254:126901. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.micres.2021.126901

    Article  PubMed  Google Scholar 

  44. Samad A, Trognitz F, Compant S, Antonielli L, Sessitsch A. Shared and host-specific microbiome diversity and functioning of grapevine and accompanying weed plants. Environ Microbiol. 2017;19(4):1407–24. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/1462-2920.13618

    Article  PubMed  Google Scholar 

  45. Świątczak J, Kalwasińska A, Szabó A, Brzezinska MS. The effect of seed bacterization with Bacillus paralicheniformis 2R5 on bacterial and fungal communities in the canola rhizosphere. Microbiol Res. 2023;275:127448. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.micres.2023.127448

    Article  PubMed  Google Scholar 

  46. Zhao X, Zhu D, Tan J, Wang R, Qi G. Cooperative action of fulvic acid and Bacillus paralicheniformis ferment in regulating soil microbiota and improving soil fertility and plant resistance to bacterial wilt disease. Microbiol Spectr. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/spectrum.04079-22

  47. Hou Y, Wei C, Zeng W, Hou M, Wang Z, Xu G, Huang J, Ao C. Application of rhizobacteria to improve microbial community structure and maize (Zea mays L.) growth in saline soil. Environ Sci Pollut Res Int. 2024;31(2):2481–94. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s11356-023-31361-3

    Article  PubMed  Google Scholar 

  48. Świątczak J, Kalwasińska A, Szabó A, Swiontek Brzezinska M. Pseudomonas sivasensis 2RO45 inoculation alters the taxonomic structure and functioning of the canola rhizosphere microbial community. Front Microbiol. 2023;14:1168907. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fmicb.2023.1168907

    Article  PubMed  PubMed Central  Google Scholar 

  49. Zhang Y, Wang B, Zhang J, Liu Y, Tang D, Zhao J, Dai C. By reconstructing a multifunctional intensive microbiome, effective microorganisms (EM) improve the ecological environment of rice–crayfish cocropping. Agric Ecosyst Environ. 2023;357:108698. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.agee.2023.108698

    Article  Google Scholar 

  50. Kennedy TA, Naeem S, Howe KM, Knops JM, Tilman D, Reich P. Biodiversity as a barrier to ecological invasion. Nature. 2002;417(6889):636–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/nature00776

    Article  PubMed  Google Scholar 

  51. Nishino SF, Paoli GC, Spain JC. Aerobic degradation of dinitrotoluenes and pathway for bacterial degradation of 2,6-dinitrotoluene. Appl Environ Microbiol. 2000;66(5):2139–47. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/AEM.66.5.2139-2147.2000

    Article  PubMed  PubMed Central  Google Scholar 

  52. Hatzinger PB, McClay K, Vainberg S, Tugusheva M, Condee CW, Steffan RJ. Biodegradation of methyl tert-butyl ether by a pure bacterial culture. Appl Environ Microbiol. 2001;67(12):5601–7. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/AEM.67.12.5601-5607.2001

    Article  PubMed  PubMed Central  Google Scholar 

  53. Zeng ZQ, Zhuang WY. Three new species of Fusicolla (Hypocreales) from China. J Fungi (Basel). 2023;9(5):572. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/jof9050572

    Article  PubMed  Google Scholar 

  54. Li W, Long Y, Mo F, Shu R, Yin X, Wu X, Zhang R, Zhang Z, He L, Chen T, Chen J. Antifungal activity and biocontrol mechanism of Fusicolla Violacea J-1 against soft rot in kiwifruit caused by Alternaria alternata. J Fungi (Basel). 2021;7(11):937. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/jof7110937

    Article  PubMed  Google Scholar 

  55. Jin X, Rahman MKU, Ma C, Zheng X, Wu F, Zhou X. Silicon modification improves biochar’s ability to mitigate cadmium toxicity in tomato by enhancing root colonization of plant-beneficial bacteria. Ecotoxicol Environ Saf. 2023;249:114407. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ecoenv.2022.114407

    Article  PubMed  Google Scholar 

  56. Naqqash T, Hameed S, Imran A, Hanif MK, Majeed A, van Elsas JD. Differential response of potato toward inoculation with taxonomically diverse plant growth promoting rhizobacteria. Front Plant Sci. 2016;7:144. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fpls.2016.00144

    Article  PubMed  PubMed Central  Google Scholar 

  57. Dunlap CA, Schisler DA, Perry EB, Connor N, Cohan FM, Rooney AP. Bacillus swezeyi sp. nov. and Bacillus haynesii sp. nov., isolated from desert soil. Int J Syst Evol Microbiol. 2017;67(8):2720–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1099/ijsem.0.002007

    Article  PubMed  Google Scholar 

  58. Guo Q, Dong W, Li S, Lu X, Wang P, Zhang X, Wang Y, Ma P. Fengycin produced by Bacillus subtilis NCD-2 plays a major role in biocontrol of cotton seedling damping-off disease. Microbiol Res. 2014;169(7–8):533–40. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.micres.2013.12.001

    Article  PubMed  Google Scholar 

  59. Madslien EH, Rønning HT, Lindbäck T, Hassel B, Andersson MA, Granum PE. Lichenysin is produced by most Bacillus licheniformis strains. J Appl Microbiol. 2013;115(4):1068–80. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/jam.12299

    Article  PubMed  Google Scholar 

  60. Zhu J, Wang S, Wang C, Wang Z, Luo G, Li J, Zhan Y, Cai D, Chen S. Microbial synthesis of bacitracin: recent progress, challenges, and prospects. Synth Syst Biotechnol. 2023;8(2):314–22. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.synbio.2023.03.009

    Article  PubMed  PubMed Central  Google Scholar 

  61. Dimopoulou A, Theologidis I, Benaki D, Koukounia M, Zervakou A, Tzima A, Diallinas G, Hatzinikolaou DG, Skandalis N. Direct antibiotic activity of bacillibactin broadens the biocontrol range of Bacillus amyloliquefaciens MBI600. mSphere. 2021;6(4):e0037621. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/mSphere.00376-21

    Article  PubMed  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was funded by Shandong Provincial Key Research and Development Program (Major Science and Technology Innovation Project) - Boost Plan for Rural Vitalization Science and Technology Innovation (No. 2021TZXD001), the National Natural Science Foundation of China (32170133 and 31700094), State Key Laboratory for Managing Biotic and Chemical Treats to the Quality and Safety of Agro-products (No. 2021DG700024-KF202314), and the State Key Laboratory of Microbial Technology Open Projects Fund (No. M2023-11).

Author information

Author notes

  1. Yanan Sun and Kai Liu contributed equally to this work.

Authors and Affiliations

  1. College of Life Sciences, National Engineering Research Center for Efficient Utilization of Soil and Fertilizer Resources, Shandong Key Laboratory of Agricultural Microbiology, Shandong Agricultural University, 61 Daizong Street, Tai’an, 271018, China

    Yanan Sun, Kai Liu, Yayu Liu, Xuerong Yang, Binghai Du, Xiang Li, Bo Zhou & Chengqiang Wang

  2. Tai’an Academy of Agricultural Sciences, Tai’an, 271000, China

    Zhongliang Liu

  3. Key Laboratory of Food Processing Technology and Quality Control in Shandong Province, College of Food Science and Engineering, Shandong Agricultural University, Tai’an, 271018, China

    Ningyang Li

  4. College of Food Science and Engineering, Ocean University of China, Qingdao, 266003, China

    Ningyang Li

  5. State Key Laboratory for Managing Biotic and Chemical Treats to the Quality and Safety of Agro-products, Zhejiang Academy of Agricultural Sciences, Hangzhou, 310021, China

    Xueming Zhu

  6. State Key Laboratory of Microbial Technology, Institute of Microbial Technology, Shandong University, Qingdao, 266237, China

    Hailong Wang

  7. ARC Centre of Excellence in Synthetic Biology, School of Biology and Environmental Science, Faculty of Science, Queensland University of Technology, Brisbane, QLD, 4000, Australia

    Bingyin Peng

Authors
  1. Yanan Sun
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Kai Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Zhongliang Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Yayu Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Xuerong Yang
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Binghai Du
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Xiang Li
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Ningyang Li
    View author publications

    You can also search for this author inPubMed Google Scholar

  9. Bo Zhou
    View author publications

    You can also search for this author inPubMed Google Scholar

  10. Xueming Zhu
    View author publications

    You can also search for this author inPubMed Google Scholar

  11. Hailong Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

  12. Bingyin Peng
    View author publications

    You can also search for this author inPubMed Google Scholar

  13. Chengqiang Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Yanan Sun and Kai Liu performed the main experiments in the lab. Zhongliang Liu, Yayu Liu, and Xuerong Yang analyzed the whole genome and the application in ginger field of strain SYN-191. Binghai Du, Xiang Li, Ningyang Li, Bo Zhou, and Hailong Wang advised the manuscript. Bingyin Peng edited the language of the manuscript. Xueming Zhu and Chengqiang Wang designed the experiments and wrote the manuscript. All authors have read the manuscript and agree to submit it to BMC Microbiology.

Corresponding authors

Correspondence to Xueming Zhu or Chengqiang Wang.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Sun, Y., Liu, K., Liu, Z. et al. Bacillus paralicheniformis SYN-191 isolated from ginger rhizosphere soil and its growth-promoting effects in ginger farming. BMC Microbiol 25, 75 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12866-025-03791-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12866-025-03791-1

Keywords

BMC Microbiology

ISSN: 1471-2180

Contact us