Contribution of icaADBC genes in biofilm production ability of Staphylococcus aureus clinical isolates collected from hospitalized patients at a burn center in North of Iran

Table 1 Sequences of primers and PCR conditions used to amplify the nuc, and IcaABCD genes

Genes	Sequences (5ʹ to 3ʹ)	Denaturation temperature and time	Annealing temperature and time	Extension temperature and time	Final Extension temperature and time	Amplicon Size (bp)	Reference
nuc- F	AGCTCAGCAAATGCATCACA	95 °C for 25 s	53˚C for 30 s	72˚C for 30 s	72˚C for 5 min	400	[20]
nuc- R	TAGCCAAGCCTTGACGAACT	95 °C for 25 s	53˚C for 30 s	72˚C for 30 s	72˚C for 5 min	400	[20]
icaA- F	GAGGTAAAGCCAACGCACTC	95 °C for 25 s	53˚C for 30 s	72˚C for 30 s	72˚C for 5 min	151	[21]
icaA- R	CCTGTAACCGCACCAAGTTT	95 °C for 25 s	53˚C for 30 s	72˚C for 30 s	72˚C for 5 min	151
icaB- F	ATACCGGCAACTGGGTTTAT	95 °C for 25 s	52˚C for 30 s	72˚C for 30 s	72˚C for 5 min	141
icaB- R	ATGCAAATCGTGGGTATGTGT	95 °C for 25 s	52˚C for 30 s	72˚C for 30 s	72˚C for 5 min	141
icaC- F	CTTGGGTATTTGCACGCATT	95 °C for 25 s	53˚C for 30 s	72˚C for 30 s	72˚C for 5 min	209
icaC- R	GCAATATCATGCCGACACCT	95 °C for 25 s	53˚C for 30 s	72˚C for 30 s	72˚C for 5 min	209
icaD- F	ACCCAACGCTAAAATCATCG	95 °C for 25 s	52˚C for 30 s	72˚C for 30 s	72˚C for 5 min	211
icaD- R	GCGAAAATGCCCATAGTTTC	95 °C for 25 s	52˚C for 30 s	72˚C for 30 s	72˚C for 5 min	211

ISSN: 1471-2180